
Problem 79. DNA N-Gram Distribution

Solution 1639974

Submitted on 8 Oct 2018 by Philippe S.
  • Size: 7
  • This is the leading solution.
This solution is locked. To view this solution, you need to provide a solution of the same size or smaller.

Test Suite

Test Status Code Input and Output
1   Pass
s = 'AACTGAACG'; n = 3; hifreq_correct = 'AAC'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

[Warning: Function assert has the same name as a MATLAB builtin. We suggest you rename the function to avoid a potential name conflict.] [> In unix (line 32) In nGramFrequency (line 2) In ScoringEngineTestPoint1 (line 4) In solutionTest (line 3)]

2   Pass
s = 'dynamic routing service'; n = 2; hifreq_correct = 'ic'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

[Warning: Function assert has the same name as a MATLAB builtin. We suggest you rename the function to avoid a potential name conflict.] [> In unix (line 32) In nGramFrequency (line 2) In ScoringEngineTestPoint2 (line 4) In solutionTest (line 5)]

3   Pass
s = 'Your veracity is exceeded by your sagacity.'; n = 5; hifreq_correct = 'acity'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

[Warning: Function assert has the same name as a MATLAB builtin. We suggest you rename the function to avoid a potential name conflict.] [> In unix (line 32) In nGramFrequency (line 2) In ScoringEngineTestPoint3 (line 4) In solutionTest (line 7)]

4   Pass
s = 'AGCGAAGGAAGGATCACATTTCTCAGGACAAAGGCATTTCACTAATGGTT'; n = 3; hifreq_correct = 'AGG'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

[Warning: Function assert has the same name as a MATLAB builtin. We suggest you rename the function to avoid a potential name conflict.] [> In unix (line 32) In nGramFrequency (line 2) In ScoringEngineTestPoint4 (line 4) In solutionTest (line 9)]

5   Pass
s = 'In short, in matters vegetable, animal, and mineral, I am the very model of a modern Major-General.'; n = 2; hifreq_correct = 'er'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

[Warning: Function assert has the same name as a MATLAB builtin. We suggest you rename the function to avoid a potential name conflict.] [> In unix (line 32) In nGramFrequency (line 2) In ScoringEngineTestPoint5 (line 4) In solutionTest (line 11)]

Suggested Problems

More from this Author95

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!