Community Profile

photo

nora elfiky


4 total contributions since 2016

nora elfiky's Badges

  • Thankful Level 1

View details...

Contributions in
View by

Question


Error using reshape pls help me
appear this error how I can solve it Can you help me solve this problem? size MINO 1x524286 >>p...

3 years ago | 1 answer | 0

1

answer

Question


Apply One Time Pad Step (plain text, key) to get amino acids of cipher [AC].
hi I need help plaintext=TGCACGGCTTGCTGCGGTACCTGCTGCGGGACTGGGTGCGGCATTTTTCGGGTTGTGGGACGGGGTGCGGTACGGGGT; Key=AAGCGCGATTGT...

3 years ago | 0 answers | 0

0

answers

Question


How to put data in vector into matrix
How to put data in vector into matrix and then changes the position of bits in the matrix. It can be applied in row wise or colu...

3 years ago | 2 answers | 0

2

answers

Question


How can convert vector aa size 1x262144 to matrix 256x256
hi every one i'm new her i need help size of aa 1x262144 i want convert to matrix 256x256

3 years ago | 2 answers | 0

2

answers