Window length Selection size for DNA sequence?
3 views (last 30 days)
Show older comments
i have a DNA sequence like
ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 so how to do this?? please drop a code
0 Comments
Answers (0)
See Also
Categories
Find more on Genomics and Next Generation Sequencing in Help Center and File Exchange
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!