I am trying to assign a pattern of alphabets to a sequence of alphabets that I have.

2 views (last 30 days)
seq_file = fopen('insulinDNAseq.txt');
template5_3 = fscanf(seq_file,'%s');
seq_len = length(template5_3);
template3_5 = [flip(template5_3)];
A = {'a' 't'
'c' 'g'
'g' 'c'
't' 'a'};
I am supposed to modify the code below in order to get a stand of alphabets of a,c,g,t. On the process above, I import a document of a sequence of alphabets and flip it front a back. I need to modify the code below in order to assign a new alphabet and come up with a new strand according to the pattern A shown above. I am attaching the text file with the question.
for i = 1:seq_len
template_base = template3_5(i); % pull the ith base of the template strand
row_A = strcmp(template_base,A(:,1)); % identify the row in matrix A corresponding to templateBase; note that the variable row_A is a boolean vector
% Define the base added to the synthesized strand using matrix 'A' and
% vector 'row_A'
synth_base = [row_A];
% Store synth_base in the ith element of your storage vector. You'll
% need to use the command 'char' to store the character properly.
[];
end

Answers (2)

VBBV
VBBV on 19 Feb 2024
Edited: VBBV on 19 Feb 2024
seq_file = fopen('insulinDNAseq.txt');
template5_3 = fscanf(seq_file,'%s');
seq_len = length(template5_3);
template3_5 = [flip(template5_3)];
A = {'a' 't'
'c' 'g'
'g' 'c'
't' 'a'};
for i = 1:seq_len
for k = 1:size(A,2)
template_base = template3_5(i); % pull the ith base of the template strand
row_A = strcmp(template_base,A(:,k)); % identify the row in matrix A corresponding to templateBase; note that the variable row_A is a boolean vector
% Define the base added to the synthesized strand using matrix 'A' and
% vector 'row_A'
synth_base{i} = A{[row_A]};
% Store synth_base in the ith element of your storage vector. You'll
% need to use the command 'char' to store the character properly.
[];
end
end
synth_base{:}
ans = 'a'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'c'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'g'
ans = 'a'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'g'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 't'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'a'
ans = 'a'
ans = 'g'
ans = 'a'
ans = 'g'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 'a'
ans = 't'
ans = 'c'
ans = 'a'
ans = 'a'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'a'
ans = 't'
ans = 'c'
ans = 'a'
ans = 'c'
ans = 't'
ans = 'g'
ans = 't'
ans = 'c'
ans = 'c'
ans = 't'
ans = 't'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 'a'
ans = 't'
ans = 'g'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'g'
ans = 't'
ans = 'g'
ans = 'g'
ans = 'a'
ans = 't'
ans = 'g'
ans = 'c'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'g'
ans = 'c'
ans = 'g'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'g'
ans = 'g'
ans = 'g'
ans = 'a'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'a'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 't'
ans = 't'
ans = 't'
ans = 'g'
ans = 't'
ans = 'g'
ans = 'a'
ans = 'a'
ans = 'c'
ans = 'c'
ans = 'a'
ans = 'a'
ans = 'c'
ans = 'a'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'g'
ans = 't'
ans = 'g'
ans = 'c'
ans = 'g'
ans = 'g'
ans = 'c'
ans = 't'
ans = 'c'
ans = 'a'
ans = 'c'
ans = 'a'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'g'
ans = 't'
ans = 'g'
ans = 'g'
ans = 'a'
ans = 'a'
ans = 'g'
ans = 'c'
ans = 't'
ans = 'c'
ans = 't'
ans = 'c'
ans = 't'
ans = 'a'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'a'
ans = 'g'
ans = 't'
ans = 'g'
ans = 't'
ans = 'g'
ans = 'c'
ans = 'g'
ans = 'g'
ans = 'g'
ans = 'g'
ans = 'a'
ans = 'a'
ans = 'c'
ans = 'g'
ans = 'a'
ans = 'g'
ans = 'g'
ans = 'c'
ans = 't'
ans = 't'
ans = 'c'
ans = 't'
ans = 't'
ans = 'c'
ans = 't'
ans = 'a'
ans = 'c'
ans = 'a'
ans = 'c'
ans = 'a'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 'a'
ans = 'a'
ans = 'g'
ans = 'a'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 'g'
ans = 'g'
ans = 'g'
ans = 'a'
ans = 'g'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'a'
ans = 'g'
ans = 'g'
ans = 'a'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'g'
ans = 't'
ans = 'g'
ans = 'g'
ans = 'g'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'g'
ans = 't'
ans = 'g'
ans = 'g'
ans = 'a'
ans = 'g'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'g'
ans = 'g'
ans = 'c'
ans = 'g'
ans = 'g'
ans = 'g'
ans = 'g'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'g'
ans = 't'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 't'
ans = 't'
ans = 'g'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'g'
ans = 'a'
ans = 'g'
ans = 'g'
ans = 'g'
ans = 'g'
ans = 't'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'a'
ans = 'a'
ans = 'g'
ans = 'c'
ans = 'g'
ans = 't'
ans = 'g'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 't'
ans = 't'
ans = 'g'
ans = 't'
ans = 'g'
ans = 'g'
ans = 'a'
ans = 'a'
ans = 'c'
ans = 'a'
ans = 'a'
ans = 't'
ans = 'g'
ans = 'c'
ans = 't'
ans = 'g'
ans = 't'
ans = 'a'
ans = 'c'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 't'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'c'
ans = 't'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'c'
ans = 't'
ans = 'a'
ans = 'c'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'g'
ans = 'a'
ans = 'g'
ans = 'a'
ans = 'a'
ans = 'c'
ans = 't'
ans = 'a'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 'a'
ans = 'c'
ans = 't'
ans = 'a'
ans = 'g'
ans = 'a'
ans = 'c'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 'a'
ans = 'c'
ans = 'a'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'c'
ans = 'c'
ans = 't'
ans = 'g'
ans = 'c'
ans = 'a'
ans = 'c'
ans = 'c'
ans = 'g'
ans = 'a'
ans = 'g'
ans = 'a'
ans = 'g'
ans = 'a'
ans = 'g'
ans = 'a'
ans = 't'
ans = 'g'
ans = 'g'
ans = 'a'
ans = 'a'
ans = 't'
ans = 'a'
ans = 'a'
ans = 'a'
ans = 'g'
ans = 'c'
ans = 'c'
ans = 'c'
ans = 't'
ans = 't'
ans = 'g'
ans = 'a'
ans = 'a'
ans = 'c'
ans = 'c'
ans = 'a'
ans = 'g'
ans = 'c'
  2 Comments
SANGBIN LEE
SANGBIN LEE on 19 Feb 2024
is there a way for me to display all the sequence of alphabets in a single strand of alphabets
VBBV
VBBV on 19 Feb 2024
seq_file = fopen('insulinDNAseq.txt');
template5_3 = fscanf(seq_file,'%s');
seq_len = length(template5_3);
template3_5 = [flip(template5_3)];
A = {'a' 't'
'c' 'g'
'g' 'c'
't' 'a'};
for i = 1:seq_len
for k = 1:size(A,2)
template_base = template3_5(i); % pull the ith base of the template strand
row_A = strcmp(template_base,A(:,k)); % identify the row in matrix A corresponding to templateBase; note that the variable row_A is a boolean vector
% Define the base added to the synthesized strand using matrix 'A' and
% vector 'row_A'
synth_base(i) = A{[row_A]};
% Store synth_base in the ith element of your storage vector. You'll
% need to use the command 'char' to store the character properly.
[];
end
end
disp(synth_base) %
agccctccaggacaggctgcatcagaagaggccatcaagcagatcactgtccttctgccatggccctgtggatgcgcctcctgcccctgctggcgctgctggccctctggggacctgacccagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacctagtgtgcggggaacgaggcttcttctacacacccaagacccgccgggaggcagaggacctgcaggtggggcaggtggagctgggcgggggccctggtgcaggcagcctgcagcccttggccctggaggggtccctgcagaagcgtggcattgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgcaactagacgcagcccgcaggcagccccacacccgccgcctcctgcaccgagagagatggaataaagcccttgaaccagc

Sign in to comment.


Voss
Voss on 19 Feb 2024
seq_file = fopen('insulinDNAseq.txt');
template5_3 = fscanf(seq_file,'%s');
fclose(seq_file); % close the file when you're done reading it!!!
template3_5 = flip(template5_3);
A = {'a' 't'
'c' 'g'
'g' 'c'
't' 'a'};
[ism,idx] = ismember(template3_5,[A{:,1}]);
assert(all(ism),'Not all characters are a, c, g, or t')
synth_base = [A{idx,2}];
disp(synth_base)
agccctccaggacaggctgcatcagaagaggccatcaagcagatcactgtccttctgccatggccctgtggatgcgcctcctgcccctgctggcgctgctggccctctggggacctgacccagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacctagtgtgcggggaacgaggcttcttctacacacccaagacccgccgggaggcagaggacctgcaggtggggcaggtggagctgggcgggggccctggtgcaggcagcctgcagcccttggccctggaggggtccctgcagaagcgtggcattgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgcaactagacgcagcccgcaggcagccccacacccgccgcctcctgcaccgagagagatggaataaagcccttgaaccagc

Categories

Find more on Tables in Help Center and File Exchange

Products


Release

R2023b

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!