DNA fragments are made by DNA sequencer.
To find full sequence, we need to concatenate each other using common sequence information.
So, when Input sequences are
(1) ATCGATCGAAGTCATCGGGAAA
(3) GGAAAGATCGATTACTTCCGAAA
(2) CCGAAAACCTAAGGGTTCTCAATGAC .
Output sequence is
'ATCGATCGAAGTCATCGGGAAAGATCGATTACTTCCGAAAACCTAAGGGTTCTCAATGAC' .
Solution Stats
Solution Comments
Show comments
Loading...
Problem Recent Solvers4
Suggested Problems
-
2609 Solvers
-
315 Solvers
-
Make a random, non-repeating vector.
11743 Solvers
-
564 Solvers
-
USC Fall 2012 ACM : Find Largest Water Concentration
11 Solvers
More from this Author2
Problem Tags
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!