DNA fragments are made by DNA sequencer.
To find full sequence, we need to concatenate each other using common sequence information.
So, when Input sequences are
(1) ATCGATCGAAGTCATCGGGAAA
(3) GGAAAGATCGATTACTTCCGAAA
(2) CCGAAAACCTAAGGGTTCTCAATGAC .
Output sequence is
'ATCGATCGAAGTCATCGGGAAAGATCGATTACTTCCGAAAACCTAAGGGTTCTCAATGAC' .
Solution Stats
Solution Comments
Show comments
Loading...
Problem Recent Solvers5
Suggested Problems
-
Which values occur exactly three times?
5255 Solvers
-
2021 Solvers
-
Get the area codes from a list of phone numbers
1078 Solvers
-
Back to basics 8 - Matrix Diagonals
974 Solvers
-
Get the elements of diagonal and antidiagonal for any m-by-n matrix
525 Solvers
More from this Author2
Problem Tags
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!
