Problem 47513. DNA Sequence Assembly
DNA fragments are made by DNA sequencer.
To find full sequence, we need to concatenate each other using common sequence information.
So, when Input sequences are
(1) ATCGATCGAAGTCATCGGGAAA
(3) GGAAAGATCGATTACTTCCGAAA
(2) CCGAAAACCTAAGGGTTCTCAATGAC .
Output sequence is
'ATCGATCGAAGTCATCGGGAAAGATCGATTACTTCCGAAAACCTAAGGGTTCTCAATGAC' .
Solution Stats
Solution Comments
Show commentsProblem Recent Solvers3
Suggested Problems
-
Find relatively common elements in matrix rows
1989 Solvers
-
4353 Solvers
-
Choose the best fitting dominoes
206 Solvers
-
159 Solvers
-
Set the array elements whose value is 13 to 0
1343 Solvers
More from this Author2
Problem Tags
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!