DNA fragments are made by DNA sequencer.
To find full sequence, we need to concatenate each other using common sequence information.
So, when Input sequences are
(1) ATCGATCGAAGTCATCGGGAAA
(3) GGAAAGATCGATTACTTCCGAAA
(2) CCGAAAACCTAAGGGTTCTCAATGAC .
Output sequence is
'ATCGATCGAAGTCATCGGGAAAGATCGATTACTTCCGAAAACCTAAGGGTTCTCAATGAC' .
Solution Stats
Solution Comments
Show comments
Loading...
Problem Recent Solvers5
Suggested Problems
-
Make the vector [1 2 3 4 5 6 7 8 9 10]
53712 Solvers
-
Remove any row in which a NaN appears
8794 Solvers
-
634 Solvers
-
135 Solvers
-
Calculate the Number of Sign Changes in a Row Vector (No Element Is Zero)
978 Solvers
More from this Author2
Problem Tags
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!
